Sio 2 Books > Basic Science > Amyloid precursor protein : a practical approach - download pdf or read online

Amyloid precursor protein : a practical approach - download pdf or read online

By Weiming Xia, Huaxi Xu

ISBN-10: 0849322456

ISBN-13: 9780849322457

Within the look for an efficient remedy for Alzheimer's illness, APP is a different version protein that illustrates the big range of uncomplicated and complicated characterization concepts on hand.

Exploring quite a few organic options to explain the constitution and serve as of this transmembrane protein, this article provides each one procedure with precise, step by step protocols to accomplish reproducible effects and supply a framework for learning different membrane proteins.

Show description

Read Online or Download Amyloid precursor protein : a practical approach PDF

Similar basic science books

New PDF release: RNA Viruses: A Practical Approach

This ebook offers a extensive therapy of the rules and perform of RNA virus study to insure the widest attainable viewers. it truly is excellent for laboratories concerned about virus tradition, together with either educational and commercial examine teams and public well-being laboratories.

Fungi in Biogeochemical Cycles (British Mycological Society - download pdf or read online

Fungi play very important roles within the biking of parts within the biosphere yet are usually ignored inside of microbiological and geochemical study spheres. Symbiotic mycorrhizal fungi are accountable for significant adjustments and redistribution of inorganic food, whereas free-living fungi have significant roles within the decomposition of natural fabrics, together with xenobiotics.

Download e-book for iPad: The Unfolded Protein Response and Cellular Stress, Part B by P. Michael Conn

This quantity offers descriptions of the incidence of the UPR, tools used to evaluate it, pharmacological instruments and different methodological techniques to research its influence on mobile rules. The authors clarify how those equipment may be able to supply vital organic insights. This quantity offers descriptions of the incidence of the UPR, equipment used to evaluate it, pharmacological instruments and different methodological ways to research its effect on mobile law.

Molecular Mechanisms of Immunological Self-Recognition by Fredrick W. Alt, Frederick Alt, Henry J. Vogel PDF

The contributions during this publication disguise B phone tolerance, lymphocyte signalling, T cellphone tolerance and autoimmunity. The textual content might be of curiosity to technologists, molecular and phone biologists, physiologists, geneticists and microbiologists

Extra info for Amyloid precursor protein : a practical approach

Sample text

3. 0. 4. 34% (yeast nitrogen base without amino acids, 4 × 10-5% w/v) biotin, 1% dextrose, and 15 g agar for 1 liter. 5. Yeast extract peptone methanol (YPM) consisting of 1% (w/v) bacto yeast extract, 2% (w/v) peptone, and 3% (v/v) methanol. 2 METHOD FOR CLONING 1. The DNA encoding GFD is generated by polymerase chain reactin (PCR) using primers GGTCGACAAAAGAGAGGCTCTGCTGGCTGAACCCCAGATTG and GAATTCTTATACAAACTCACCAACTAAG. 2. The PCR product is cloned as a Xho1-EcoR1 fragment into the P. pastoris vector pIC9 (Invitrogen).

2. The cells are chilled on ice for 15 min and washed with ice cold DPBS to stop membrane trafficking. 3. Coverslips are then incubated with anti-APP monoclonal antibodies (1G7 alone or combined with 5A3) in cold DPBS for 1 hr on ice. 4. The cells are washed 5 times with cold DPBS and then incubated with prewarmed regular medium for various times (0 to 60 min) at 37°C. The cells are then fixed with cold 4% formaldehyde (freshly prepared from paraformaldehyde) in PBS for 15 min. 5. 3% Triton X-100 in PBS, washed 3 times with PBS, and incubated with fluorescein isothionate (FITC)-conjugated anti-mouse secondary antibody for 1 hr at room temperature.

Et al. The solution structure of the N-terminal domain of hepatocyte growth factor reveals a potential heparin-binding site. Structure 6, 109, 1998. 30. J. et al. Solution structure of the heparin-binding domain of vascular endothelial growth factor. Structure 6, 637, 1998. 31. U. et al. From differentiation to proliferation: the secretory amyloid precursor protein as a local mediator of growth in thyroid epithelial cells. Proc. Natl. Acad. Sci. USA 95, 1770, 1998. 32. A. C. Amyloid precursor protein modulates the interaction of nerve growth factor with p75 receptor and potentiates its activation of trkA phosphorylation.

Download PDF sample

Amyloid precursor protein : a practical approach by Weiming Xia, Huaxi Xu


by Michael
4.2

Rated 4.74 of 5 – based on 10 votes